custom-designed small interfering rna (sirna) (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher custom-designed small interfering rna (sirna)
Custom Designed Small Interfering Rna (Sirna), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom-designed+small+interfering+rna+(sirna)/pm38642047-115-8-12
Average 90 stars, based on 1 article reviews

custom-designed small interfering rna (sirna) - by Bioz Stars, 2026-10

90/100 stars

Images

Transfection:

Article Title: PKC regulates αKlotho gene expression in MDCK and NRK-52E cells.
Article Snippet: .. Cells were then transfected with custom-designed PKCγ small interfering RNA (siRNA) (25 nM; sense: ACA AGU UAC UGA ACC AGG Att, antisense: UCC UGG UUC AGU AAC UUG UAC, Invitrogen, Thermo Fisher Scientific, Darmstadt, Germany), custom-designed PKCη siRNA (25 nM; sense: GAA AUG GGA UCG GAG UUA Att, antisense: UUA ACU CCG AUC CCA UUU Ccc, Invitrogen) or 25 nM non-targeting control siRNA (#4390843, Invitrogen) using 5-μl Lipofectamine RNAiMAX (Invitrogen) transfection reagent in antibiotic-free complete medium for 24 h. For silencing of NRK-52E cells, 1.5×105 cells per well were grown in complete medium for 24 h and then transfected with custom-designed PKCγ siRNA (50 nM; sense: ACA AGU UAC UGA ACC AGG Att, antisense: UCC UGG UUC AGU AAC UUG UAC, Invitrogen) or 50 nM nontargeting control siRNA (#4390843, Invitrogen) using 5 μl DharmaFECT 1 (Horizon Discovery, Cambridge, UK) transfection reagent in antibiotic-free complete medium for 24 h. Silencing efficiency was determined by quantitative real-time PCR. .. Cells were washed with ice-cold PBS and total RNA was isolated using TriFast (Peqlab, Erlangen, Germany).

Article Title: The lipopolysaccharide-TLR4 axis regulates hepatic glutaminase 1 expression promoting liver ammonia build-up as steatotic liver disease progresses to steatohepatitis.
Article Snippet: Introduction: Ammonia is a pathogenic factor implicated in the progression of metabolic-associated steatotic liver disease (MASLD).. The contribution of the glutaminase 1 (GLS) isoform, an enzyme converting glutamine to glutamate and ammonia, to hepatic ammonia build-up and the mechanisms underlying its upregulation in metabolic-associated steatohepatitis (MASH) remain elusive.. Methods: Multiplex transcriptomics and targeted metabolomics analysis of liver biopsies in dietary mouse models representing the whole spectra of MASLD were carried out to characterize the relevance of hepatic GLS during disease pathological progression.

Small Interfering RNA:

Control:

Real-time Polymerase Chain Reaction:

Injection:

In Vivo:

Sequencing:

Article Title: Septins Regulate Bacterial Entry into Host Cells
Article Snippet: .. Custom scramble sequence, as well as pre-designed siRNA for SEPT2 (ID#14709) were both from Ambion, and handled according to manufacturer's instructions. ..

other:

Article Title: Cucurbitacin B attenuates osteoarthritis development by inhibiting NLRP3 inflammasome activation and pyroptosis through activating Nrf2/HO-1 pathway.
Article Snippet: Funding information Basic Public Welfare Research Project of Zhejiang Province, Grant/Award Number: LQ24H060008; Zhejiang Medicine Health Science and Technology Program, Grant/Award Number: 2022RC209; Wenzhou Science and Technology Plan Project, Grant/Award Numbers: 2021Y0301, Y20210050, Y2023043 Abstract Osteoarthritis (OA) is a complicated joint disorder characterized by inflammation that causes joint destruction.. Cucurbitacin B (CuB) is a naturally occurring triterpenoid compound derived from plants in the Cucurbitaceae family.. The aim of this study is to investigate the potential role and mechanisms of CuB in a mouse model of OA.

Article Title: PKC regulates αKlotho gene expression in MDCK and NRK-52E cells
Article Snippet: Cells were then transfected with custom-designed PKCγ small interfering RNA (siRNA) (25 nM; sense: ACAAGUUACUGAACCAGGAtt, antisense: UCCUGGUUCAGUAACUUGUAC, Invitrogen, Thermo Fisher Scientific, Darmstadt, Germany), custom-designed PKCη siRNA (25 nM; sense: GAAAUGGGAUCGGAGUUAAtt, antisense: UUAACUCCGAUCCCAUUUCcc, Invitrogen) or 25 nM non-targeting control siRNA (#4390843, Invitrogen) using 5-μl Lipofectamine RNAiMAX (Invitrogen) transfection reagent in antibiotic-free complete medium for 24 h. For silencing of NRK-52E cells, 1.5×10 5 cells per well were grown in complete medium for 24 h and then transfected with custom-designed PKCγ siRNA (50 nM; sense: ACAAGUUACUGAACCAGGAtt, antisense: UCCUGGUUCAGUAACUUGUAC, Invitrogen) or 50 nM non-targeting control siRNA (#4390843, Invitrogen) using 5 μl DharmaFECT 1 (Horizon Discovery, Cambridge, UK) transfection reagent in antibiotic-free complete medium for 24 h. Silencing efficiency was determined by quantitative real-time PCR.

Review